Wyniki wyszukiwania - AGRO

1

The lectin-binding pattern of nucleolin and its interaction with endogenous galectin-3

100%

Hoja-Lukowicz D., Kedracka-Krok S., Duda W., Litynska A.

Cellular and Molecular Biology Letters

|

2014

|

tom 19

|

nr 3

Unlike nuclear nucleolin, surface-expressed and cytoplasmic nucleolin exhibit Tn antigen. Here, we show localization-dependent differences in the glycosylation and proteolysis patterns of nucleolin. Our results provide evidence for different paths of nucleolin proteolysis in the nucleus, in the cytoplasm, and on the cell surface. We found that full-length nucleolin and some proteolytic fragments coexist within live cells and are not solely the result of the preparation procedure. Extranuclear nucleolin undergoes N- and O-glycosylation, and unlike cytoplasmic nucleolin, membrane-associated nucleolin is not fucosylated. Here, we show for the first time that nucleolin and endogenous galectin-3 exist in the same complexes in the nucleolus, the cytoplasm, and on the cell surface of melanoma cells. Assessments of the interaction of nucleolin with galectin-3 revealed nucleolar co-localization in interphase, suggesting that galectin-3 may be involved in DNA organization and ribosome biogenesis.

2

Artykuł dostępny w postaci pełnego tekstu - kliknij by otworzyć plik

Two-way profile analysis with interaction

100%

Zielinski W.

Colloquium Biometricum

|

2009

|

tom 39

3

Interaction of polyelectrolyte gels and surface active agents

100%

Zielinska E., Maslinska-Solich J., Lekawska E.

Polish Journal of Environmental Studies

|

1999

|

tom 08

|

nr 5

Hydrogel polymers can absorb surface active agents from the water environment, which can be practically applied for their removal from waters polluted with detergents. The carried out investigation studies involved the interaction of maleic anhydride copolymers with vinyl ethers when subjected to crosslinking with various crosslinking agents, as well as generated in Poland cationic, anionic and non-ionic surfactants. A very high absorption of cationic surfactant by the hydrogels has been found, which can be applied in the vicinity of plants using such surfactants, e.g. dairies. Poly(vinyl) alcohol crosslinked with glutaraldehyde, was used as hydrogel too, and it doesn't absorb cationic surfactants.

4

The study of interactions between FAD - flavin adenine dinucleotide and histidine

100%

Sabara D.

Zeszyty Naukowe. Politechnika Łódzka. Chemia Spożywcza i Biotechnologia

|

2008

|

tom 72

5

Studies of ionic admixture-lipid membrane surface interactions

100%

Podolak M., Man D.

Cellular and Molecular Biology Letters

|

2002

|

tom 07

|

nr Suppl.

6

Magnesium supplements affect selected cadmium toxic actions and uptake of repeated doses of cadmium

88%

Grosicki A., Malagocki P., Kycko A., Monkiewicz P., Korol W.

Bulletin of the Veterinary Institute in Puławy

|

2015

|

tom 59

|

nr 4

The importance of magnesium supplements on organ retention of cadmium and allometric parameters after repeated exposure to cadmium chloride were studied in male Wistar rats. Magnesium chloride was given via drinking water (500 mg Mg/L) to rats exposed intragastrically to cadmium chloride (labelled with cadmium 109) at a daily dose corresponding to 25 mg/kg diet for 7, 14, 21, and 28 d. Supplements of magnesium temporarily decreased cadmium retention in the duodenum and liver. No significant differences in cadmium retention were evidenced in the kidneys and testicles. The supplements of magnesium also retain more of the body weight gains and restore the relative liver and testicle weight in rats intoxicated with cadmium. Comparison of the present results with earlier reports suggests a relationship between doses of magnesium and cadmium; higher doses of cadmium need more magnesium to overcome toxic action of the heavy metal.

7

Vyvod uravnenijj dlja opredelenija nagruzok, voznikajushhikh v ob'eme organicheskikh udobrenijj v processe formirovanii valka

88%

Melnik V., Romanashenko A.

Motrol. Motoryzacja i Energetyka Rolnictwa

|

2013

|

tom 15

|

nr 7

8

Two-way profile analysis with interaction: an application to microbiological experiment

88%

Zielinski W., Gorska E. B.

Colloquium Biometricum

|

2009

|

tom 39

9

Interaction of spectrin with the low molecular weight phosphotyrosine phosphatase [LMW-PTP]

88%

Lecomte M. C., Nicolas G., Fournier C., Galand C., Malbert-Colas L., Bournier O., Dhermy D., Grandchamp B.

Cellular and Molecular Biology Letters

|

2001

|

tom 06

|

nr 2

10

Interaction between different FSH drugs and selected factors affecting the rate of superovulation in cows

88%

Jaskowski J. M., Znaniecki R.

Bulletin of the Veterinary Institute in Puławy

|

1997

|

tom 41

|

nr 1

Analysis of multiple regression of data obtained on 347 donor cows revealed a statistically significant interaction (P<0.001) between FSH drugs and: 1- the age of cows. 2 - month of examination and the number of transferable embryos and month of their yields. 3 – the number of superovulations per cycle and the number of transferable embryos.

11

Interaction of class A G protein-coupled receptors with G proteins

88%

Slusarz R., Ciarkowski J.

Acta Biochimica Polonica

|

2004

|

tom 51

|

nr 1

A model for interaction of class A G protein-coupled receptor with the G protein Ga subunit is proposed using the rhodopsin-transducin (RD/Gt) prototype. The model combines the resolved interactions/distances, essential in the active RD*/Gt system, with the structure of Gta C-terminal peptide bound to RD* while stabilizing it. Assuming the interactions involve conserved parts of the partners, the model specifies the conserved Helix 2 non-polar X- - -X, Helix 3 DRY and Helix 7/8 NP- -Y- - F RD* motifs interacting with the Gta C-terminal peptide, in compliance with the structure of the latter. A concomitant role of Gta and Gtγ C-termini in stabilizing RD* could possibly be resolved assuming a receptor dimer as requisite for G protein activation.

12

Computer studies of fluorescein-PE-interaction with the lipid bilayer

88%

Kubica K.

Cellular and Molecular Biology Letters

|

2002

|

tom 07

|

nr Suppl.

13

Effect of trimethoprim on trichloroethylene metabolism

88%

Zieba-Proc B., Orlowski J.

Acta Poloniae Toxicologica

|

1996

|

tom 04

|

nr 1

14

The impact of the amino-acid sequence on the specificity of copper[II] interactions with peptides having nonco-ordinating side-chains

88%

Bal W., Dyba M., Kozlowski H.

Acta Biochimica Polonica

|

1997

|

tom 44

|

nr 3

The review presents specific interactions that occur in complexes of Cu(ll) ions with peptides composed only of amino acids with nonco-ordinating side chains. Three classes of such peptides are discussed. The first type (NSFRY analogues) is characterised by the presence of a specific combination of bulky and aromatic residues, leading to a formation of multiple weak interactions around Cu(II) that result in an extremely high stability of complexes. The second class is composed of complexes of vasopressins and oxytocins, achieving superstability through a pre-conformation in the peptide molecule. The third group are oligopeptides containing one or two proline residues. These peptides form exotic macrochelate loops with Cu(ll) in a result of the break-point effect of Pro residues. Particular emphasis in the review was given to stability constants of complexes, compared to oligoglycine or oligoalanine peptides.

15

Thermal stability of DNA as affected by the organophosphorus insecticide Dichlorvos

88%

Blasiak J., Kleinwachter V., Walter Z., Zaludova R.

Polish Journal of Environmental Studies

|

1996

|

tom 05

|

nr 2

The interaction of the commonly used organophosphorus insecticide dichlorvos (2,2-dichlorovinyl dimethyl phosphate) with synthetic and mammalian DNA was investigated by spectroscopic techniques. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and synthetic two-stranded oligomer of sequence 5' - d(TTGGATCCGAATTCAAGCTT)-3' Melting curves and circular dichroism spectra were taken for the DNAs in the presence of the insecticide at a dichlorvos/DNA molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were much less pronounced than in the case of CT DNA. Dichlorvos did not evoke significant changes in the circular dichroism spectra of both DNAs. Obtained results indicate that dichlorvos perturbs the thermal stability of DNA, which is evidence that the insecticide has the ability to interact directly with DNA. Because dichlorvos is primarily neurotoxic, evidence of non-specific effect could be important for assessing the environmental risk connected with its use.

16

Detection of novel DNA-nuclear matrix interactions

88%

Ferraro A., Altieri F., Cervoni L., Eufemi M., Coppari S., Turano C.

Cellular and Molecular Biology Letters

|

1997

|

tom 02

|

nr 2

17

Interaction of methyl jasmonate and ethephon in gum formation in tulip bulbs

88%

Saniewski M., Ueda J., Miyamoto K., Okubo H., Puchalski J.

Polish Journal of Natural Sciences. Supplement

|

2003

|

tom 01

18

The interaction of amphotericin B and zeaxanthin in lipid membranes: A spectroscopic study

88%

Gagos M., Herec M., Gruszecki W. I.

Cellular and Molecular Biology Letters

|

2002

|

tom 07

|

nr Suppl.

19

Sugars and chloroplast movements: interaction between sugars and light signalling pathway

88%

Banas A. K., Gabrys H.

Polish Journal of Natural Sciences. Supplement

|

2003

|

tom 01

20

Elastic vesicles: interaction with human skin and drug transport

88%

Bouwstra J. A., De Graaff A., Groenink W., Honeywell L.

Cellular and Molecular Biology Letters

|

2002

|

tom 07

|

nr 2

Ograniczanie wyników