Preferencje help
Polish version English version Język
Widoczny [Schowaj] Abstrakt
Liczba wyników

Znaleziono wyników: 19

Liczba wyników na stronie
Pierwsza strona wyników Pięć stron wyników wstecz Poprzednia strona wyników Strona / 1 Następna strona wyników Pięć stron wyników wprzód Ostatnia strona wyników

Wyniki wyszukiwania

Wyszukiwano:
w słowach kluczowych:  organophosphorus insecticide
help Sortuj według:

help Ogranicz wyniki do:
Pierwsza strona wyników Pięć stron wyników wstecz Poprzednia strona wyników Strona / 1 Następna strona wyników Pięć stron wyników wprzód Ostatnia strona wyników
1

Thermal stability of DNA as affected by the organophosphorus insecticide Dichlorvos

100%
Blasiak J., Kleinwachter V., Walter Z., Zaludova R.
Polish Journal of Environmental Studies
|
1996
|
tom 05
|
nr 2
The interaction of the commonly used organophosphorus insecticide dichlorvos (2,2-dichlorovinyl dimethyl phosphate) with synthetic and mammalian DNA was investigated by spectroscopic techniques. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and synthetic two-stranded oligomer of sequence 5' - d(TTGGATCCGAATTCAAGCTT)-3' Melting curves and circular dichroism spectra were taken for the DNAs in the presence of the insecticide at a dichlorvos/DNA molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were much less pronounced than in the case of CT DNA. Dichlorvos did not evoke significant changes in the circular dichroism spectra of both DNAs. Obtained results indicate that dichlorvos perturbs the thermal stability of DNA, which is evidence that the insecticide has the ability to interact directly with DNA. Because dichlorvos is primarily neurotoxic, evidence of non-specific effect could be important for assessing the environmental risk connected with its use.
2

Effects of organophosphorus insecticide phosphamidon on ciliate protozoan Tetrahymena pyriformis

86%
Agarwal M., Saxena D. M.
Acta Protozoologica
|
1990
|
tom 29
|
nr 1
3

Changes in the fluidity of model lipid membranes evoked by the organophosphorus insecticide methylbromfenvinfos

86%
Blasiak J.
Acta Biochimica Polonica
|
1993
|
tom 40
|
nr 1
4

Membrane fluidity as affected by the organophosphorus insecticide menthylbromfenvinfos

86%
Blasiak J.
Polish Journal of Environmental Studies
|
1996
|
tom 05
|
nr 1
The interaction of methylbromfenvinfos with model and native membranes was investigated using fluorescence anisotropy of 1,6-diphenyl-1,3,5-hexatriene (DPH), a probe located in the hydrophobic core of the bilayer and l,3-bis-(l-pyrene) propane, a probe distributed in the outer region of the bilayer. DPH reported a broadening of the transition profile and solidifying effects in the fluid phase of liposomes formed from dimyristoyl (DMPC), dipalmitoyl (DPPC), and distearoyl (DSPC) phosphatidylcholine in the presence of 50 μM of the insecticide. Py(3)Py detected an ordering effect of the insecticide in the fluid state of the lipids and abolished pretransition in DPPC and DSPC vesicles. Cholesterol added to DMPC decreased the influence of the insecticide. The effect of methylbromfenvinfos on the fluidity of some native membranes, namely erythrocytes, lymphocytes, brain microsomes, and sarcoplasmic reticulum, depended on the cholesterol content of these membranes.
5

Erythrocyte membrane [Ca2plus plus Mg2plus]-ATPase as affected by organophosphorus insecticides

86%
Blasiak J.
Polish Journal of Environmental Studies
|
1995
|
tom 04
|
nr 4
The organophosphorus insecticide bromfenvinfos (2-bromo-l-(2,4-dichlorophenyl)vinyl diethyl phosphate) and its methylated homologue methylbromfenvinfos inhibited noncompetitively the activity of (Ca2+ + Mg2+)-ATPase bound to and solubilized from pig erythrocyte membrane. Both enzyme preparations exhibited biphasic substrate curves displaying the existence of two functional active sites with low and high affinity to ATP. Inhibition of activity was more pronounced for bromfenvinfos than for methylbromfenvinfos and the solubilized enzyme preparation was more affected than the bound one. The results of the experiment suggest that the insecticides inhibited the ATPase by binding to a site on the enzyme rather than by interaction with associated lipids, although their presence could weaken the action of the compounds due to the stronger affinity of organophosphorus insecticides for lipids rather than for proteins.
6

Activity of lysosomal enzymes in acute intoxication with organophosphorus insecticides

86%
Lukaszewicz-Hussain A., Moniuszko-Jakoniuk J.
Polish Journal of Environmental Studies
|
1997
|
tom 06
|
nr 1
The aim of this paper was to examine the activity of lysosomal enzymes after intoxication with chlorfenvinvos and dichlorvos - phosphoorganic insecticides. Investigations were carried out on male Wistar rats weighing 180-230 g. Rats were divided into two groups: control and treated. Rats of treated group were receiving oil solution of chlorfenvinvos at doses of 0.5 LD50 or 0.1 LD5(), determinations were performed after 1 and 24 hours after treatment or dichlorvos in the dose equal to 0.5 LD50 estimations were performed after 1 h only. Rats of control group were given equivalent volume of oil. Activities of beta-glucuronidase and acid phosphatase in the blood serum and lysosomal fraction of rat liver homogenate were determined. It was found that the level of ChE inhibition and increase of BGR activity in the serum were dependant on chemical structure of used compound, dose and time after treatment. It was observed that increase of hydrolases activities in serum was accompanied by the decrease in its activity in the lysosomal fraction of liver homogenate.
7

Voltammetric determination of fenitrothion

86%
Pawlak M. K.
Polish Journal of Environmental Studies
|
2004
|
tom 13
|
nr 4
The adsorptive stripping differential pulse voltammetric method was proposed for the determination of fenitrothion [O,O-dimethyl O-(4-nitro-m-tolyl)phosphorothioate]. The voltammetric response was evaluated in 0,04 mol -1 Britton-Robinson buffer with respect to the accumulation time and potential, and concentration dependence. The relationship between peak current and fenitrothion concentration was linear within the range of 1x10-8 – 1x10-6 mol l-1. In spiked water the detection limit of fenitrothion, estimated from 3 times the standard deviation, was 36 ng l-1. Interference from some other organophosphorus insecticides on the determination of fenitrothion were studied.
8

Effect of an organophosphorous insecticide, malathion, on pavement cells of the gill epithelia of Channa punctatus [Bloch].

72%
Sawhney A. K., Johal M. S.
Polskie Archiwum Hydrobiologii
|
2000
|
tom 47
|
nr 2
9

Calcium uptake by sarcoplasmic reticulum in the presence of methylparathion

72%
Blasiak J.
Biophysics of Membrane Transport
|
1994
|
tom 12
|
nr 2
10

Single cell gel electrophoresis [comet assay] as a tool for environmental biomonitoring. An example of pesticides

72%
Blasiak J., Trzeciak A.
Polish Journal of Environmental Studies
|
1998
|
tom 07
|
nr 4
Methods that permit the sensitive detection of DNA damage and repair are of special significance in the field of environmental research due to the long latent period between exposure to environmental agent(s) and genetic effect(s) becoming apparent. Malathion is a commonly used organophosphorus insecticide reported to be genotoxic both in vivo and in vitro, but the reports are conflicting. In order to elucidate the genotoxic potency of a compound present in commercial preparations of malathion, the DNA damaging effect of the insecticide and its isomer isomalathion was investigated using alkaline single cell gel electrophoresis (comet assay). Freshly isolated human peripheral blood lymphocytes were incubated with 75 and 200 µM of the chemicals for 1 h. The concentrations from the range we used, is relevant to that in blood following various nonlethal human exposure to pesticides. Malathion did not cause any significant changes in the comet length of the lymphocytes throughout the range of concentrations tested. Isomalathion introduced damage to DNA in a dose-dependent manner. Treated cells were able to recover within the 60 min incubation in insecticide-free medium at 37°C. The reported genotoxicity of malathion might, therefore, be a consequence of its thermal and/or photochemical conversion to isomalathion and the presence of isomalathion as well as its oxidation products and other unspecified impurities in commercial formulations of malathion. In this regard, the results of our study indicate that malathion used as commercial product, i. e. containing isomalathion, can be considered as a genotoxic substance in vitro. This means that it can produce DNA disturbances in vivo. Therefore, malathion can be regarded as a potential mutagen/carcinogen and requires further investigation.
11

Effect of starvation on the free amino acids pool in an organophosphorus - insecticide - resistant and a susceptible strain of Tribolium castaneum

72%
Saleem M. A., Shakoori A. R.
Folia Biologica
|
1995
|
tom 43
|
nr 3-4
12

Influence of dimethoate on the structure and function of the natural phytoplankton assemblage of the Darss-Zingst bodden chain reared in a laboratory

72%
Mohapatra P. K., Schiewer U.
Polish Journal of Environmental Studies
|
1996
|
tom 05
|
nr 2
The toxic effect of the organophosphorus (OP) insecticide dimethoate on the structure and function of natural phytoplankton assemblage of brackish lake water of the Darss-Zingst bodden chain was tested in a laboratory under both short- and long-term incubation. A decrease in photosynthetic activity, an increase of photosystem II (PS II) fluorescence emission and acceleration of respiratory O2 consumption were observed as immediate responses (1 h treatment) by the sample to the OP insecticide taken at concentrations of up to 1 mg/1. Long-term exposure (8 days) of the phytoplankton assemblage to the chemical caused elimination of the sensitive species, a change in phytoplankton density and diversity, a decrease of photosynthetic activity and differential fluorescence responses of PS II. A direct relation to the number of eliminated species with insecticide concentrations and days of incubation was observed. All the tested concentrations were found to be toxic to the phytoplankton assemblage albeit acceleration of growth of certain species at 0.01 mg/1 of the insecticide. The monitoring of the fluorescence response cf PS II and respiratory O2 consumption were considered convincing parameters for short-term toxicity assessment while photosynthetic efficiency and phytoplankton diversity were found to be better indicators of long-term toxicity exposure.
13

Calcium uptake by sarcoplasmic reticulum in the presence of the organophosphorus insecticide methylparathion

72%
Blasiak J.
Polish Journal of Environmental Studies
|
1995
|
tom 04
|
nr 1
Using an isotope labelling technique it has been shown that an organophosphorus insecticide methylparathion (0,0-diethyl 0-4-nitrophenyl phosphorothioate) depressed calcium uptake by sarcoplasmic reticulum isolated from rabbit hind leg muscle. The effect was significant for insecticide concentrations of 50 and 100 µM and was dose-dependent The insecticide exerted a more pronounced effect on calcium uptake in the presence of ATP in the reticulum environment than in the absence of ATP. The inhibitory action of methylparathion on Ca2+ accumulation by sarcoplasmic reticulum can cause a rise in myoplasmic free Ca2+, the essential prerequisite for contracture activation. Because methylparathion, as well as other organophosphorus insecticides, is primarily neurotoxic, evidence of non-specific effect could be important for assessing its environmental safety.
14
Artykuł dostępny w postaci pełnego tekstu - kliknij by otworzyć plik
Content available

Zastosowanie insektycydów fosforoorganicznych w dezynsekcji sanitarnej

58%
Bojanowska A.
Roczniki Państwowego Zakładu Higieny
|
1962
|
tom 13
|
nr 3
15

Current status of resistance in Colorado potato beetle [Leptinotarsa decemlineata Say] to selected active substances of insecticides in Poland

58%
Wegorek P.
Journal of Plant Protection Research
|
2005
|
tom 45
|
nr 4
309-319
Chemical plant protection is still an indispensable method in effective potato protection against Colorado potato beetle – CPB – (Leptinotarsa decemlineata Say) in Poland. This species is able to develop strong resistance against all active substances used in chemical and biological insecticides. The phenomenon of resistance is variable in time and in space. Therefore the objective of the study was to determine the present susceptibility level of Polish populations of CPB to main groups of insecticides recommended in Poland for CPB control.
16

DNA breaking activity of the pesticide malathion and its metabolite assayed by the single cell gel electrophoresis [comet assay]

58%
Blasiak J., Trzeciak A., Jaloszynski P., Szyfter K., Osiecka R., Blaszczyk A.
Cellular and Molecular Biology Letters
|
1997
|
tom 02
|
nr 4
Genotoxicity of pesticides is of a special significance because of the common presence of these agents in the environment and the long latent period between the exposure and effects becoming apparent. The DNA damaging effects of the commonly used organophosphorus insecticide malathion and its major metabolite malaoxon were evaluated. Freshly isolated human peripheral blood lymphocytes were incubated with 75 and 300 µM of malathion or malaoxon for 1 h. Sensitive alkaline microgel single cell electrophoresis (comet assay) was used to assess damage to the lymphocyte DNA. Possible lesions detected by this technique could be single- and double-strand DNA breaks as well as alkali-labile sites. Malaoxon, unlike malathion, induced DNA damage in a dose-dependent manner. The effect of malaoxon at 300 µM was comparable with the effect of hydrogen peroxide at 20 µM. Well recognized genotoxic effects of malathion may be a consequence either of the interaction of its major metabolite malaoxon with DNA or use of technical grade of malathion which contains impurities, including malaoxon. However, humans are exposed to the pesticide of technical grade and have the ability to metabolize malathion to malaoxon and in this regard malathion used as an organophosphorus insecticide can be considered as a genotoxic substance.
17

Anion transport across the red blood cell membrane in the presence of malathion and parathion and their main metabolites

58%
Blasiak J.
Cellular and Molecular Biology Letters
|
1996
|
tom 01
|
nr 4
The effect of organophosphorus insecticides malathion and parathion as well as their main metabolites malaoxon and paraoxon on chloride (36Cl-) and sulfate (35SO42-) equilibrium exchange in pig erythrocytes was investigated using an isotope labelling technique. Efflux of both radioactive isotopes vs. time followed a single exponential. Parathion and paraoxon inhibited the chloride equilibrium exchange in intact ceils in a dose- and time-dependent manner. There was no difference between effects evoked by these two compounds. Neither malathion nor malaoxon affected the chloride transport. Parathion and paraoxon inhibited sulfate efflux from resealed ghosts. The effect was also dose- and time-dependent. Again, there was no difference between action of the agents. No effect of malathion and malaoxon on sulfate efflux was observed. Dixon analysis revealed noncompetitive character of the inhibition of the exchange of both anions with the apparent Ki, values 68 and 73 µM for parathion and paraoxon, respectively in the case of chloride transport; for sulfate exchange these values were 341 and 340 µM, respectively. It was suggested that structural similarity between parent agents and their metabolites is responsible for the identity of their effects. Parathion and paraoxon could inhibit the anion exchange indirectly by changing the fluidity of the erythrocyte membrane or directly by binding to the Band 3 protein and evoking conformational changes leading to the inhibition of the anion transport. The insecticides, due to their ability to phosphorylate, could also disturb some regulation processes in the Band 3 protein.
18

Inhibition of [Na a. K]-ATPase by organophosphorus insecticides

58%
Blasiak J.
Polish Journal of Environmental Studies
|
1995
|
tom 04
|
nr 1
The organophosphorus insecticide bromfenvinios and its methylated homologue methylbrom- fenvinfos inhibited the activity of pig kidney (Na++K+)-ATPase contained in the microsomal fraction and purified from it. The effect was dose-dependent Subrate kinetic studies of the enzyme revealed the existence of two active sites with high and low affinity to ATP respectively. The Dixon analysis of the mode of inhibition indicated its noncompetitive character. The inhibition was more pronouced for bromfenvinfos than for methylbromfenvinfos and the purified enzyme was more affected than the enzyme contained in the microsomal fraction. The Hill plot of inhibition indicated a multisite binding of both insecticides exhibiting cooperativity in binding. The Hill coefficient (n) fulfilled the relationship 1 < n < 3. These properties of the interaction suggest an allosteric nature of the inhibitory action of the insecticides. An indirect mechanism of the interaction was proposed: methylparathion could inhibit the activity of the (Na+ + K+)-ATPase by excluding the enzyme protein from its normal lipid milieu.
19

Owadobójcze przynęty

51%
Matawowski A.
Wszechświat
|
1957
|
nr 02
Pierwsza strona wyników Pięć stron wyników wstecz Poprzednia strona wyników Strona / 1 Następna strona wyników Pięć stron wyników wprzód Ostatnia strona wyników
JavaScript jest wyłączony w Twojej przeglądarce internetowej. Włącz go, a następnie odśwież stronę, aby móc w pełni z niej korzystać.