Wyniki wyszukiwania

1

Artykuł dostępny w postaci pełnego tekstu - kliknij by otworzyć plik

Alteration in thermal stability of collagen and collagen-chondroitin-6-sulphate complex induced by histamine

100%

Dabrowski R.

Acta Physiologica Polonica

|

1987

|

tom 38

|

nr 5

2

Thermal stability of DNA as affected by the organophosphorus insecticide Dichlorvos

100%

Blasiak J., Kleinwachter V., Walter Z., Zaludova R.

Polish Journal of Environmental Studies

|

1996

|

tom 05

|

nr 2

The interaction of the commonly used organophosphorus insecticide dichlorvos (2,2-dichlorovinyl dimethyl phosphate) with synthetic and mammalian DNA was investigated by spectroscopic techniques. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and synthetic two-stranded oligomer of sequence 5' - d(TTGGATCCGAATTCAAGCTT)-3' Melting curves and circular dichroism spectra were taken for the DNAs in the presence of the insecticide at a dichlorvos/DNA molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were much less pronounced than in the case of CT DNA. Dichlorvos did not evoke significant changes in the circular dichroism spectra of both DNAs. Obtained results indicate that dichlorvos perturbs the thermal stability of DNA, which is evidence that the insecticide has the ability to interact directly with DNA. Because dichlorvos is primarily neurotoxic, evidence of non-specific effect could be important for assessing the environmental risk connected with its use.

3

Review of the industrial applications of bacterial cellulose

86%

Michalowski M., Wacikowski B.

Annals of Warsaw University of Life Sciences - SGGW. Forestry and Wood Technology

|

2020

|

tom 109

4

Bio-inspired trypsin-chitosan cross-linked enzyme aggregates: a versatile approach for stabilization through carrier-free immobilization

86%

Mageed H. A., Ezz N. A., Radwan R.

BioTechnologia. Journal of Biotechnology Computational Biology and Bionanotechnology

|

2019

|

tom 100

|

nr 3

5

Thermal stability of hyperbranched polyglycerols esterified with dicarboxylic acid and phthalic anhydride applicable as hot melt adhesives

86%

Maminski M., Jaskolowski W.

Annals of Warsaw University of Life Sciences - SGGW. Forestry and Wood Technology

|

2012

|

tom 78

6

Stability of reconstituted casein systems against calcium ions, high temperature and ethanol

86%

Minkiewicz P., Dziuba J., Darewicz M., Mioduszewska H.

Polish Journal of Natural Sciences

|

2002

|

tom 10

7

Activated carbons from plum stones

72%

Pawlicka A., Doczekalska B., Bartkowiak M., Janecka M.

Annals of Warsaw University of Life Sciences - SGGW. Forestry and Wood Technology

|

2014

|

tom 85

8

Postroenie optimizacionnojj zadachi teplovykh processov pri lazernom delenii ehmbriona

72%

Levkin A., Levkin D.

Motrol. Motoryzacja i Energetyka Rolnictwa

|

2013

|

tom 15

|

nr 7

9

Effect of vibration frequency and exposure time on the technological usability of fresh milk

72%

Warminska M., Kruk A., Brandt W.

Polish Journal of Food and Nutrition Sciences

|

2006

|

tom 15/56

|

nr Spec.Issue 1

A study was undertaken in order to monitor the effect of vibrations with variable frequency (10-60 Hz) and different times of exposure to vibrations (30 and 120 min) on changes in selected physicochemical properties of milk, especially those determining its technological usability. Vibrations were found to negatively affect the properties of milk significant from the technological point of view, producing a slight increase in its acidity and conductance, a decrease in thermal and ethanolic stability as well as a reduction in the time of rennet coagulation of raw milk, among other effects. The changes of the analysed milk traits as affected by vibrations were observed to depend on the frequency band applied and to intensify with an increasing frequency and elongated time of milk exposure to vibrations, thus exerting a significant, negative impact on its technological usability.

10

The role of lysine-256 in the structure and function of sheep liver recombinant serine hydroxymethyltransferase

72%

Talwar R., Jagath J. R., Datta A., Prakash V., Savithri H. S., Rao N. A.

Acta Biochimica Polonica

|

1997

|

tom 44

|

nr 4

The active site lysine residue, K256, involved in Schiff's base linkage with pyridoxal-5'-phosphate (PLP) in sheep liver recombinant serine hydroxymethyltransferase (rSHMT) was changed to glutamine or arginine by site-directed mutagenesis. The purified K256Q and K256R SHMTs had less than 0.1% of catalytic activity with serine and H4folate as substrates compared to rSHMT. The mutant enzymes also failed to exhibit the characteristic visible absorbance spectrum (lambda(max) 425 nm) and did not produce the quinonoid intermediate (lambda(max) 495 nm) upon the addition of glycine and H4folate. The mutant enzymes were unable to catalyze aldol cleavage of beta-phenylserine and transamination of D-alanine. These results suggested that the mutation of the lysine had resulted in the inability of the enzyme to bind to the cofactor. Therefore, the K256Q SHMT was isolated as a dimer and the K256R SHMT as a mixture of dimers and tetramers which were converted to dimers slowly. On the other hand, rSHMT was stable as a tetramer for several months, further confirming the role of PLP in maintenance of oligomeric structure. The mutant enzymes also failed to exhibit the increased thermal stability upon the addition of serine, normally observed with rSHMT. The enhanced thermal stability has been attributed to a change in conformation of the enzyme from open to closed form leading to reaction specificity. The mutant enzymes were unable to undergo this conformational change probably because of the absence of bound cofactor.

11

Bioactivity of Bowman Birk inhibitors in thermally processed orange juice

58%

del Castillo M. D., Amigo-Benavent M., Bravo L.

Polish Journal of Food and Nutrition Sciences

|

2011

|

tom 61

|

nr Suppl.1

12

Termostabilnosc roslinnych inhibitorow proteaz przewodu pokarmowego

58%

Chlabicz M., Gacko M., Guzowski A., Krupkowska A., Bankowska A.

Bromatologia i Chemia Toksykologiczna

|

2005

|

tom 38

|

nr Supl.

337-339

Nasiona niektórych roślin spożywanych przez człowieka zawierają inhibitory pepsyny, a wszystkie gatunki roślin zawierają inhibitory trypsyny i chymotrypsyny. Ogrzewanie obniża aktywność tych inhibitorów.

13

A novel Gly to Arg substitution at position 388 of the alpha1 chain of type I collagen in lethal form of osteogenesis imperfecta

58%

Galicka A., Wolczynski S., Lesniewicz R., Chyczewski L., Gindzienski A.

Acta Biochimica Polonica

|

2002

|

tom 49

|

nr 2

Cultured skin fibroblasts from a proband with a lethal form of osteogenesis imperfecta produce two forms of type I collagen chains, with normal and delayed elec- trophoretic migration; collagen of the proband's mother was normal. Peptide mapping experiments localized the structural defect in the proband to a 1(I) CB8 peptide in which residues 123 to 402 are spaned. Direct sequencing of amplified cDNA covering this region revealed a G to A single base change in one allele of the al(I) chain, that converted glycine 388 to arginine. Restriction enzyme digestion of the RT-PCR product was consistent with a heterozygous COL1A1 mutation. The novel mutation conforms to the linear gradient of clinical severity for the αl(I) chain and results in reduced thermal stability by 3°C and intracellular retention of abnormal molecules.

14

Studies of interaction between [m-AMSA] and DNA by viscometric and melting profiles methods

58%

Leszczynski T., Dunski H.

Zeszyty Naukowe. Politechnika Łódzka. Chemia Spożywcza i Biotechnologia

|

2006

|

tom 70

15

Wplyw dodatku skrobi modyfikowanej na jakosc kutrowanych kielbas parzonych

44%

Dzieszuk W., Dworecka E., Szmanko T.

Acta Scientiarum Polonorum. Technologia Alimentaria

|

2005

|

tom 04

|

nr 1

Określono wpływ 2%, 4% i 6% dodatku skrobi modyfikowanej (fosforanu dwuskrobiowego) na jakość kutrowanych kiełbas parzonych. Rosnący udział dodatku polisacharydów w składzie recepturowym eksperymentalnych kiełbas miał wpływ na zwiększenie stabilności cieplnej farszów, zdolności utrzymywania wody oraz zmniejszenie ubytków podczas obróbki wędzarniczo-parzelniczej. Stwierdzono zwiększenie jasności fotometrycznej i udziału barwy żółtej w widmie odbiciowym farszu oraz poprawę właściwości Teologicznych kiełbas wyprodukowanych z udziałem skrobi modyfikowanej. Najwyższą jakością pod względem ogólnej (średniej) oceny sensoiycznej charakteryzowały się wyroby wyprodukowane z dodatkiem 4% polisacharydów. Ze względu na nadmierną twardość i gumowatość produktów finalnych, nieuzasadnione jest zwiększanie zawartości skrobi w farszu wędlin drobno rozdrobnionych powyżej 4%.

16

Rozpuszczalnosc i stabilnosc cieplna albumin i globulin nasion bobiku [Vicia faba L.] - charakterystyka i zmiany pod wplywem przechowywania

44%

Darewicz M., Kostyra H., Dziuba J.

Acta Academiae Agriculturae ac Technicae Olstenensis. Technologia Alimentorum

|

1996

|

nr 29

125-138

Ograniczanie wyników

Alteration in thermal stability of collagen and collagen-chondroitin-6-sulphate complex induced by histamine

Thermal stability of DNA as affected by the organophosphorus insecticide Dichlorvos

Review of the industrial applications of bacterial cellulose

Bio-inspired trypsin-chitosan cross-linked enzyme aggregates: a versatile approach for stabilization through carrier-free immobilization

Thermal stability of hyperbranched polyglycerols esterified with dicarboxylic acid and phthalic anhydride applicable as hot melt adhesives

Stability of reconstituted casein systems against calcium ions, high temperature and ethanol

Activated carbons from plum stones

Postroenie optimizacionnojj zadachi teplovykh processov pri lazernom delenii ehmbriona

Effect of vibration frequency and exposure time on the technological usability of fresh milk

The role of lysine-256 in the structure and function of sheep liver recombinant serine hydroxymethyltransferase

Bioactivity of Bowman Birk inhibitors in thermally processed orange juice

Termostabilnosc roslinnych inhibitorow proteaz przewodu pokarmowego

A novel Gly to Arg substitution at position 388 of the alpha1 chain of type I collagen in lethal form of osteogenesis imperfecta

Studies of interaction between [m-AMSA] and DNA by viscometric and melting profiles methods

Wplyw dodatku skrobi modyfikowanej na jakosc kutrowanych kielbas parzonych

Rozpuszczalnosc i stabilnosc cieplna albumin i globulin nasion bobiku [Vicia faba L.] - charakterystyka i zmiany pod wplywem przechowywania