Wyniki wyszukiwania

Sortuj według:

Ogranicz wyniki do:

Thermal stability of DNA as affected by the organophosphorus insecticide Dichlorvos

100%

Blasiak J., Kleinwachter V., Walter Z., Zaludova R.

Polish Journal of Environmental Studies

1996

tom 05

nr 2

The interaction of the commonly used organophosphorus insecticide dichlorvos (2,2-dichlorovinyl dimethyl phosphate) with synthetic and mammalian DNA was investigated by spectroscopic techniques. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and synthetic two-stranded oligomer of sequence 5' - d(TTGGATCCGAATTCAAGCTT)-3' Melting curves and circular dichroism spectra were taken for the DNAs in the presence of the insecticide at a dichlorvos/DNA molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were much less pronounced than in the case of CT DNA. Dichlorvos did not evoke significant changes in the circular dichroism spectra of both DNAs. Obtained results indicate that dichlorvos perturbs the thermal stability of DNA, which is evidence that the insecticide has the ability to interact directly with DNA. Because dichlorvos is primarily neurotoxic, evidence of non-specific effect could be important for assessing the environmental risk connected with its use.

Ograniczanie wyników

1 Polish Journal of Environmental Studies

1 Blasiak J.

1 Kleinwachter V.

1 Walter Z.

1 Zaludova R.

1 1996

Wyniki wyszukiwania

Thermal stability of DNA as affected by the organophosphorus insecticide Dichlorvos