PL EN


Preferencje help
Widoczny [Schowaj] Abstrakt
Liczba wyników
1996 | 05 | 2 |

Tytuł artykułu

Thermal stability of DNA as affected by the organophosphorus insecticide Dichlorvos

Języki publikacji

EN

Abstrakty

EN
The interaction of the commonly used organophosphorus insecticide dichlorvos (2,2-dichlorovinyl dimethyl phosphate) with synthetic and mammalian DNA was investigated by spectroscopic techniques. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and synthetic two-stranded oligomer of sequence 5' - d(TTGGATCCGAATTCAAGCTT)-3' Melting curves and circular dichroism spectra were taken for the DNAs in the presence of the insecticide at a dichlorvos/DNA molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were much less pronounced than in the case of CT DNA. Dichlorvos did not evoke significant changes in the circular dichroism spectra of both DNAs. Obtained results indicate that dichlorvos perturbs the thermal stability of DNA, which is evidence that the insecticide has the ability to interact directly with DNA. Because dichlorvos is primarily neurotoxic, evidence of non-specific effect could be important for assessing the environmental risk connected with its use.

Wydawca

-

Rocznik

Tom

05

Numer

2

Opis fizyczny

p.5-8,fig.,ref.

Twórcy

autor
  • University of Lodz, Banacha 12-16, 90-237 Lodz, Poland
autor
autor

Bibliografia

  • FUKUTO T.R. Mechanism of Action of OrganOphosphorus and Carbamate Insecticides. Environ. Health Pcrspect. 87, 245-254, 1990.
  • ETO M. Organophosphorus Pesticide: Organic and Biological Chemistry, CRC Press: Cleveland, pp. 123-133, 1974.
  • FLESSEL P., QUINTANA P.].E., HOOPER K. Genetic Toxicity of Malathion: A. Rewiev. Environ. Molec. Mutagen., 22, 7-17, 1993.
  • GARRETT N.E., STACK H.P., WATERS M.D. Evaluation of the Genetic Activity Profiles of 65 Pesticides. Mutation Res., 168, 301-325, 1986.
  • HERATH J.P., JALAL S.M., EBERTZ M.J., MARTSOLF J .T. Genotoxicity of the Organophosphorus Insecticide Malathion Based on Human Lymphocytes in Culture. Cytologia, 54, 191-195, 1989.
  • BRAUN R., SCHONEICH J., WEISSFLOG L., DEDECK W. Activity of OrganOphosphorus Insecticides in Bacterial Test for Mutagenicity and DNA Repair Direct Alkylation vs. Metabolic Activation and Breakdown. ]. Butonate, Vinylbutonate, Trichlorofon, Dichlorvos, Demethyl Dichlorvos and Demethyl Vinylbutonate. Chem. Biol. Interact. 39, 339-350, 1982.
  • WILD D. Mutagenicity Studies on Organophosphorus Insecticides. Mut. Res. 32, 133-150, 1975.
  • ST ERNBERG S.S. The Carcinogenesis, Mutagenesis and Teratogenesis of Insecticides, Review of Studies in Animals and Man. Pharmac. Ther., 6, 147-166, 1979.
  • WARE G.W. Pesticides, Theory and Aplication. W.H. Freeman and Company: 'San Francisco, pp. 43-44, 1983.
  • ASHWOOD-SMITH M.] ., TREVINO J., RING R. Mutagenicity of Dichlorvos. Nature, 240, 418-420, 1972.
  • BRIDGES B.A., MOTTERSHEAD R.P., GREEN M.H.L.,GRAY W.J.H. Mutagenicity of Dichlorvos and Methyl Methanesulphonate for Escherichia coli WPg and some Derivatives Deficient in DNA Repair. Mut. Res., 19, 205-303, 1975.
  • VELASQUEZ A., ANDREU H., XAMENA N., CREUS A., MARCOS R. Accumulation of Drastic Mutants in Selection Lines for Resistance to the Insecticides Dichlorvos and Malathion in Drosophila melanogaster. Experientia, 42, 1122-1123, 1987.
  • WENNERBERG R., LOFROTH G. Formation of 7-methylguanine by Dichlorvos in Bacteria and Mice. Chem.-Biol. Interactions, 8, 339-348, 1974.
  • MEHL A., SCHANKE T.M., JOHNSEN B.A., FONNUM F.The Effect of Trichlorfon and other Organophosphates on Prenatal Brain Development in the Guinea Pig. Neurochem. Res.,19, 569-574, 1994.
  • LEBLANC D.A., MORDEN K.M. Thermodynamic Characterization Of Deoxyribonucleotide Duplexes Containing Bulges. Biochemistry, 30, 4042-4047, 1991.
  • KRUGH T.R. Drug-DNA Interactions. Curr. Opin. Struct. Biol., 4, 351-364, 1994.
  • ADNET F., LIQUIER J., TAILLANDIER E., SINGH M. P.,EKAMBARESWARA R.K., LOWN J.W. FTIR Study of Specific Binding Interactions Between DNA Minor Groove Binding Ligands and Polynucleotides. J. Biomol. Struct. Dynam., 10, 565-575, 1992.
  • LEVER R., ZAKRZEWSKA K., PULLMAN B. (1986) Binding of nonintercalacting antibiotics to B-DNA: a theoretical study taking into account nucleic acid flexibility. J. Biomol. Struct. Dynam. 3, 1155-1170, 1986.
  • WADE W.S., MIRKSICH M., DERVAN P.B. Design of Peptides That Bind in the Minor Groove of DNA at 5'-(A,T)G(A,T)C(A,T)-3' Sequences by a Dimeric Side-by Si de Motif. J. Am. Chem. Soc., 114, 8783-8794, 1992.
  • MIRKSICH M., WADE W.S., DWYER T.J., GEIERSTAN GER B.H, WEMMER D.E., DERVAN P.B. Anriparalle] Side-by-Side Dimeric Motif for Sequence Recognition in the Minor groove of DNA by the Designed Peptide l-methylimi-dazole-2-carboxyamide Netropsin. Proc. Natl. Acad. Sci. USA, 89, 7586-7590, 1992.
  • DWYER T.J., GEIERSTANGER B.H., BATHINI Y., LOWN J.W., WEMMER D.E. Design and Binding of a Distamycin A Analog to d(CGCAAGTTGGC)d(GCCAACTTGCG): Synthesis, NMR Studies, and Implications for the Design of sequence Specific Minor groove Binding Oligipeptides. J. Arn. Chem. Soc., 114, 5911-5919, 192.

Identyfikator YADDA

bwmeta1.element.agro-article-cf29330f-19af-47b1-8f79-a06028ad6d95